Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3753855
End position: 3753878
Length: 24

DNA sequence
>NC_014910, from 3753855 to 3753878 (24 bp); Alicycliphilus denitrificans BC GCTGGCACTGGCGCTGGCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3753146-3754729	Sequence	Alide_3612 - methyl-viologen-reducing hydrogenase delta subunit