Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3633812
End position: 3633835
Length: 24

DNA sequence
>NC_014910, from 3633812 to 3633835 (24 bp); Alicycliphilus denitrificans BC GGCGGGCGCGGGGGCGGGGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3632922-3633848	Sequence	Alide_3478 - protoheme IX farnesyltransferase (Protein is coded in complementary strand; from 3633848 to 3632922)