Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3545274
End position: 3545300
Length: 27

DNA sequence
>NC_014910, from 3545274 to 3545300 (27 bp); Alicycliphilus denitrificans BC CACCACCAGCACCGCCAGCACCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3545005-3546207	Sequence	Alide_3392 - major facilitator superfamily mfs_1 (Protein is coded in complementary strand; from 3546207 to 3545005)