Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3366198
End position: 3366221
Length: 24

DNA sequence
>NC_014910, from 3366198 to 3366221 (24 bp); Alicycliphilus denitrificans BC CGCACGGGCACGCGCTCGCCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3360774-3366710	Sequence	Alide_3221 - alpha-2-macroglobulin (Protein is coded in complementary strand; from 3366710 to 3360774)