Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3345596
End position: 3345622
Length: 27

DNA sequence
>NC_014910, from 3345596 to 3345622 (27 bp); Alicycliphilus denitrificans BC TCGCCCAGCTCGCGCAGCTCGGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3345008-3346240	Sequence	Alide_3209 - diguanylate cyclase (Protein is coded in complementary strand; from 3346240 to 3345008)