Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3199500
End position: 3199524
Length: 25

DNA sequence
>NC_014910, from 3199500 to 3199524 (25 bp); Alicycliphilus denitrificans BC CGGCGCGGCGCGGCAGGGCGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3197876-3200782	Sequence	Alide_3071 - aconitate hydratase 1 (Protein is coded in complementary strand; from 3200782 to 3197876)