Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3186490
End position: 3186513
Length: 24

DNA sequence
>NC_014910, from 3186490 to 3186513 (24 bp); Alicycliphilus denitrificans BC CACCGCCACCACCAGCGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3184433-3187549	Sequence	Alide_3060 - acriflavin resistance protein (Protein is coded in complementary strand; from 3187549 to 3184433)