Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2845534
End position: 2845560
Length: 27

DNA sequence
>NC_014910, from 2845534 to 2845560 (27 bp); Alicycliphilus denitrificans BC TCGTGATGATCGTGATGATCGTGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2843641-2845644	Sequence	Alide_2750 - heavy metal translocating p-type atpase (Protein is coded in complementary strand; from 2845644 to 2843641)