Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2511700
End position: 2511723
Length: 24

DNA sequence
>NC_014910, from 2511700 to 2511723 (24 bp); Alicycliphilus denitrificans BC CCGGCGCCAGCGCCAGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2511577-2512698	Sequence	Alide_2440 - ABC transporter substrate-binding protein