Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2462593
End position: 2462628
Length: 36

DNA sequence
>NC_014910, from 2462593 to 2462628 (36 bp); Alicycliphilus denitrificans BC GCGCCCTGGGGCGCGACCTGGAGCGCGCGCTGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2460613-2463063	Sequence	Alide_2391 - nitrite reductase (nad(p)h), large subunit