Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2456320
End position: 2456346
Length: 27

DNA sequence
>NC_014910, from 2456320 to 2456346 (27 bp); Alicycliphilus denitrificans BC TGAACGCGCTCAACGCGCAGAACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2455711-2458854	Sequence	Alide_2389 - transporter, hydrophobe/amphiphile efflux-1 (hae1) family