Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2418626
End position: 2418649
Length: 24

DNA sequence
>NC_014910, from 2418626 to 2418649 (24 bp); Alicycliphilus denitrificans BC CCACGCTCACGCCCACGGGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2418229-2419347	Sequence	Alide_2355 - radical sam domain protein (Protein is coded in complementary strand; from 2419347 to 2418229)