Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2366849
End position: 2366875
Length: 27

DNA sequence
>NC_014910, from 2366849 to 2366875 (27 bp); Alicycliphilus denitrificans BC CAGCAGCGCCAGCAACGCCAGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2363715-2366948	Sequence	Alide_2303 - acriflavin resistance protein (Protein is coded in complementary strand; from 2366948 to 2363715)