Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2218983
End position: 2219006
Length: 24

DNA sequence
>NC_014910, from 2218983 to 2219006 (24 bp); Alicycliphilus denitrificans BC TGCGCCTGGGCCAGCGCCTGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2218887-2219267	Sequence	Alide_2169 - cobalamin (vitamin b12) biosynthesis cbix protein (Protein is coded in complementary strand; from 2219267 to 2218887)