Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 2171690
End position: 2171714
Length: 25

DNA sequence
>NC_014910, from 2171690 to 2171714 (25 bp); Alicycliphilus denitrificans BC GCAGCGCATCCCAGCCCAGCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2171050-2172405	Sequence	Alide_2124 - cl- channel voltage-gated family protein (Protein is coded in complementary strand; from 2172405 to 2171050)