Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1957857
End position: 1957880
Length: 24

DNA sequence
>NC_014910, from 1957857 to 1957880 (24 bp); Alicycliphilus denitrificans BC GGCCAGGGCAAGGACCAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957390-1957911	Sequence	Alide_1900 - hypothetical protein (Protein is coded in complementary strand; from 1957911 to 1957390)