Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1797404
End position: 1797430
Length: 27

DNA sequence
>NC_014910, from 1797404 to 1797430 (27 bp); Alicycliphilus denitrificans BC CGCGCAGCGCGGGCAGCGCGGGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1797306-1797701	Sequence	Alide_1738 - hypothetical protein (Protein is coded in complementary strand; from 1797701 to 1797306)