Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1690892
End position: 1690915
Length: 24

DNA sequence
>NC_014910, from 1690892 to 1690915 (24 bp); Alicycliphilus denitrificans BC CAGCGCGAGCGCCAGTGCCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1689954-1691147	Sequence	Alide_1618 - major facilitator superfamily mfs_1 (Protein is coded in complementary strand; from 1691147 to 1689954)