Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1688979
End position: 1689008
Length: 30

DNA sequence
>NC_014910, from 1688979 to 1689008 (30 bp); Alicycliphilus denitrificans BC GCGCCTGCGCCACCGCCTGCGCCAGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1688450-1689931	Sequence	Alide_1617 - ATP-binding region atpase domain protein (Protein is coded in complementary strand; from 1689931 to 1688450)