Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1405728
End position: 1405751
Length: 24

DNA sequence
>NC_014910, from 1405728 to 1405751 (24 bp); Alicycliphilus denitrificans BC GCCTCGGCCTCTTCCTCGGCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1404153-1406561	Sequence	Alide_1331 - RNA polymerase sigma factor rpod (Protein is coded in complementary strand; from 1406561 to 1404153)