Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1161071
End position: 1161094
Length: 24

DNA sequence
>NC_014910, from 1161071 to 1161094 (24 bp); Alicycliphilus denitrificans BC GCCACGCCCACGGCCACGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1160912-1161769	Sequence	Alide_1093 - 2-dehydro-3-deoxyphosphooctonate aldolase (Protein is coded in complementary strand; from 1161769 to 1160912)