Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3700237
End position: 3700263
Length: 27

DNA sequence
>NC_014910, from 3700237 to 3700263 (27 bp); Alicycliphilus denitrificans BC GCCCTTGCCGCCTTTGCCGCCCTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3699776-3702571	Sequence	Alide_3543 - phage tail tape measure protein, tp901 family (Protein is coded in complementary strand; from 3702571 to 3699776)