Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 1525548
End position: 1525574
Length: 27

DNA sequence
>NC_014910, from 1525548 to 1525574 (27 bp); Alicycliphilus denitrificans BC CCAGCAGGACCCGCAGGACCAGCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1525259-1525606	Sequence	Alide_1453 - hypothetical protein (Protein is coded in complementary strand; from 1525606 to 1525259)