Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 982811
End position: 982855
Length: 45

DNA sequence
>NC_014814, from 982811 to 982855 (45 bp); Mycobacterium sp. Spyr1 TCGGGTTCCTCGGCGCCGGGATCCTCGGCGCCGAGTTCCTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 981008-983023	Sequence	Mspyr1_09600 - hypothetical protein (Protein is coded in complementary strand; from 983023 to 981008)