Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 860753
End position: 860776
Length: 24

DNA sequence
>NC_014814, from 860753 to 860776 (24 bp); Mycobacterium sp. Spyr1 CGGCGGAGGCGGTGGCGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 860649-863132	Sequence	Mspyr1_08610 - membrane carboxypeptidase (Protein is coded in complementary strand; from 863132 to 860649)