Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 80853
End position: 80888
Length: 36

DNA sequence
>NC_014814, from 80853 to 80888 (36 bp); Mycobacterium sp. Spyr1 CCGCCGACGATGCCGCCGATGAAGCCGCCGCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 80118-82112	Sequence	Mspyr1_00800 - PTS system D-fructose-specific transporter subunit IIABC (Protein is coded in complementary strand; from 82112 to 80118)