Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 73493
End position: 73528
Length: 36

DNA sequence
>NC_014814, from 73493 to 73528 (36 bp); Mycobacterium sp. Spyr1 CCTCCCGGTGATCCGCCTGGTGATCCTCCCGGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 73052-74692	Sequence	Mspyr1_00740 - hypothetical protein (Protein is coded in complementary strand; from 74692 to 73052)