Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 621217
End position: 621261
Length: 45

DNA sequence
>NC_014814, from 621217 to 621261 (45 bp); Mycobacterium sp. Spyr1 TAGGGCTGGCCGTACTGGGGTTCGCCGTACTGGGGCTGGCCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 620608-621309	Sequence	Mspyr1_05950 - hypothetical protein (Protein is coded in complementary strand; from 621309 to 620608)