Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 604011
End position: 604034
Length: 24

DNA sequence
>NC_014814, from 604011 to 604034 (24 bp); Mycobacterium sp. Spyr1 CGCCACCGACACCGCCGCCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 603976-605295	Sequence	Mspyr1_05770 - hypothetical protein (Protein is coded in complementary strand; from 605295 to 603976)