Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5543850
End position: 5543903
Length: 54

DNA sequence
>NC_014814, from 5543850 to 5543903 (54 bp); Mycobacterium sp. Spyr1 GTTTCACGTGAAACATCGGTTTCGCGTGAACCCTCGGTTTCACGTGAAACAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5542950-5543960	Sequence	Mspyr1_53400 - chromosome segregation ATPase (Protein is coded in complementary strand; from 5543960 to 5542950)