Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5527930
End position: 5527953
Length: 24

DNA sequence
>NC_014814, from 5527930 to 5527953 (24 bp); Mycobacterium sp. Spyr1 CGCCGACGACGACGCAGACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5526365-5528068	Sequence	Mspyr1_53270 - hypothetical protein (Protein is coded in complementary strand; from 5528068 to 5526365)