Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5523855
End position: 5523879
Length: 25

DNA sequence
>NC_014814, from 5523855 to 5523879 (25 bp); Mycobacterium sp. Spyr1 CCCGACCGGATCCGACCCCACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5523565-5524179	Sequence	Mspyr1_53240 - transcriptional regulator (Protein is coded in complementary strand; from 5524179 to 5523565)