Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5507745
End position: 5507768
Length: 24

DNA sequence
>NC_014814, from 5507745 to 5507768 (24 bp); Mycobacterium sp. Spyr1 TCGGTGTCGGTGTCGGTGTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5504958-5508119	Sequence	Mspyr1_53110 - hypothetical protein (Protein is coded in complementary strand; from 5508119 to 5504958)