Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5439453
End position: 5439479
Length: 27

DNA sequence
>NC_014814, from 5439453 to 5439479 (27 bp); Mycobacterium sp. Spyr1 TCGCCGTGGTCGTCGTGGTCGGCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5437404-5439527	Sequence	Mspyr1_52540 - copper/silver-translocating P-type ATPase (Protein is coded in complementary strand; from 5439527 to 5437404)