Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5373343
End position: 5373387
Length: 45

DNA sequence
>NC_014814, from 5373343 to 5373387 (45 bp); Mycobacterium sp. Spyr1 GCGGGCGCGGGCCGAGCGGGCGCGGGCCGAGCGGGCGCGGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5372044-5375559	Sequence	Mspyr1_51900 - signal transduction histidine kinase (Protein is coded in complementary strand; from 5375559 to 5372044)