Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 536100
End position: 536123
Length: 24

DNA sequence
>NC_014814, from 536100 to 536123 (24 bp); Mycobacterium sp. Spyr1 GTCGATGTCGATGTGGATGTCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 534913-536319	Sequence	Mspyr1_05110 - pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase component (Protein is coded in complementary strand; from 536319 to 534913)