Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 529415
End position: 529438
Length: 24

DNA sequence
>NC_014814, from 529415 to 529438 (24 bp); Mycobacterium sp. Spyr1 GGTCTCGGTCTGCGTCTCGGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 529380-529901	Sequence	Mspyr1_05050 - hypothetical protein (Protein is coded in complementary strand; from 529901 to 529380)