Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5236752
End position: 5236796
Length: 45

DNA sequence
>NC_014814, from 5236752 to 5236796 (45 bp); Mycobacterium sp. Spyr1 CCCCCTCCACCCCGACCGCCGGCACCCCGACCCCCTCCACCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5236582-5237796	Sequence	Mspyr1_50450 - cell envelope-related transcriptional attenuator