Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5210466
End position: 5210510
Length: 45

DNA sequence
>NC_014814, from 5210466 to 5210510 (45 bp); Mycobacterium sp. Spyr1 ACCGCGCCGGGCGGCACCGCGGACGGCGGCACCGCGGTCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5209626-5210633	Sequence	Mspyr1_50200 - Cutinase (Protein is coded in complementary strand; from 5210633 to 5209626)