Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 520418
End position: 520444
Length: 27

DNA sequence
>NC_014814, from 520418 to 520444 (27 bp); Mycobacterium sp. Spyr1 GTCGTCGTGGTCGTCGTGGTCGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 520235-522061	Sequence	Mspyr1_04990 - hypothetical protein (Protein is coded in complementary strand; from 522061 to 520235)