Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5198664
End position: 5198690
Length: 27

DNA sequence
>NC_014814, from 5198664 to 5198690 (27 bp); Mycobacterium sp. Spyr1 GACCACCGCGACGACCGCCACCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5198317-5199672	Sequence	Mspyr1_50150 - serine/threonine protein kinase (Protein is coded in complementary strand; from 5199672 to 5198317)