Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 5086936
End position: 5086959
Length: 24

DNA sequence
>NC_014814, from 5086936 to 5086959 (24 bp); Mycobacterium sp. Spyr1 CGGGCGCGGGCGCGTGCGCGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5086368-5088344	Sequence	Mspyr1_49000 - DNA polymerase III subunit gamma/tau (Protein is coded in complementary strand; from 5088344 to 5086368)