Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4963343
End position: 4963387
Length: 45

DNA sequence
>NC_014814, from 4963343 to 4963387 (45 bp); Mycobacterium sp. Spyr1 TGGCGGCCTTCTTCACTGCGGTCTTCTTCACTGCGGCCTTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4963306-4966131	Sequence	Mspyr1_47780 - DNA topoisomerase I (Protein is coded in complementary strand; from 4966131 to 4963306)