Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4932610
End position: 4932636
Length: 27

DNA sequence
>NC_014814, from 4932610 to 4932636 (27 bp); Mycobacterium sp. Spyr1 CGGCTGAGGCGGCCGAGGCGGCCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4932522-4933037	Sequence	Mspyr1_47510 - 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase (Protein is coded in complementary strand; from 4933037 to 4932522)