Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4931220
End position: 4931246
Length: 27

DNA sequence
>NC_014814, from 4931220 to 4931246 (27 bp); Mycobacterium sp. Spyr1 CTGCGGGGGCTGCGGCGGCTGCTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4930756-4931913	Sequence	Mspyr1_47490 - hypothetical protein (Protein is coded in complementary strand; from 4931913 to 4930756)