Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 492335
End position: 492361
Length: 27

DNA sequence
>NC_014814, from 492335 to 492361 (27 bp); Mycobacterium sp. Spyr1 GTGGCCTCGGTGGCCTCGGTGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 491897-492370	Sequence	Mspyr1_04710 - hypothetical protein (Protein is coded in complementary strand; from 492370 to 491897)