Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4920874
End position: 4920900
Length: 27

DNA sequence
>NC_014814, from 4920874 to 4920900 (27 bp); Mycobacterium sp. Spyr1 ACCGTGGCCGCCGTGGCCACCGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4920248-4921054	Sequence	Mspyr1_47380 - hypothetical protein (Protein is coded in complementary strand; from 4921054 to 4920248)