Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4898074
End position: 4898118
Length: 45

DNA sequence
>NC_014814, from 4898074 to 4898118 (45 bp); Mycobacterium sp. Spyr1 CGTGATCGTGGCCCTCGTGATCGTGGCCCTCGTGGCCGTGGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4897536-4898531	Sequence	Mspyr1_47130 - ABC-type metal ion transporter periplasmic protein/surface adhesin (Protein is coded in complementary strand; from 4898531 to 4897536)