Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 482779
End position: 482823
Length: 45

DNA sequence
>NC_014814, from 482779 to 482823 (45 bp); Mycobacterium sp. Spyr1 CGGTGGCGGTGTCGTCGGTGTCGGCGCCGTCGGTGTCGGCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 481266-483077	Sequence	Mspyr1_04590 - lipocalin (Protein is coded in complementary strand; from 483077 to 481266)