Sequence retrieval

Genome: Mycobacterium sp. Spyr1
Start position: 4797473
End position: 4797517
Length: 45

DNA sequence
>NC_014814, from 4797473 to 4797517 (45 bp); Mycobacterium sp. Spyr1 CGTCGGAGTCGTCGACGGCGGTGTCCTCGACGACGGTGTCCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4795549-4797804	Sequence	Mspyr1_46200 - X-Pro dipeptidyl-peptidase (S15 family) (Protein is coded in complementary strand; from 4797804 to 4795549)